scpB [2019-06-25 09:59:50]

part of the condensin complex, chromosomal origin condensation and segregation

Locus: BSU23210

Isoelectric point: 4.25

Molecular weight: 21.89 kDa

Protein length: 197 aa

Gene length: 594 bp

Function: segregation of replication origins

Product: DNA segregation and condensation protein

Essential: no

Synonyms: ypuH,spcB

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Genetics → DNA condensation/ segregation

Gene

Coordinates: 2,425,248 2,425,841

Phenotypes of a mutant

• essential PubMed, non-essential according to PubMed
• scpB mutants are not viable on complex medim that allow rapid growth, but they are viable under conditions of slow growth PubMed

The protein

Catalyzed reaction/ biological activity

• negatively regulates binding of the ScpA NTD to the Smc neck region PubMed

Protein family

• scpB family (according to Swiss-Prot)

Structure

• 4I98 (complex between ScpA (aa 1-160)-ScpB (aa 1-183) PubMed

Localization

• nucleoid (Multiple) PubMed
• the condensin (Smc)₂-ScpA-ScpB complex is loaded by ParB to parS centromeric sites adjacent to the replication origin, travels then from the origin to the terminus at rates >50 kb per minute PubMed

Expression and Regulation

Operons

• Genes: scpA-scpB-ypuI
  Description: PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response

  Regulation

  • RelA dependent downregulation (Class I) during stringent response PubMed

Biological materials

Mutant

• MGNA-A105 (ypuH::erm), available at the NBRP B. subtilis, Japan
• BKE23210 (scpB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG
• BKK23210 (scpB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAATAGCTTTCCAATTCA, downstream forward: _UP4_TAGAAGTTTAATGAATCGCG

References

Reviews

Loading

Original publications

Loading